non target control Search Results


94
Addgene inc non targeting control grna
Non Targeting Control Grna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/non targeting control grna/product/Addgene inc
Average 94 stars, based on 1 article reviews
non targeting control grna - by Bioz Stars, 2026-06
94/100 stars
  Buy from Supplier

93
Addgene inc luciferase
Luciferase, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/luciferase/product/Addgene inc
Average 93 stars, based on 1 article reviews
luciferase - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

94
Addgene inc non targeting control
Non Targeting Control, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/non targeting control/product/Addgene inc
Average 94 stars, based on 1 article reviews
non targeting control - by Bioz Stars, 2026-06
94/100 stars
  Buy from Supplier

90
Addgene inc article 802169 commonly used phluorin
Article 802169 Commonly Used Phluorin, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/article 802169 commonly used phluorin/product/Addgene inc
Average 90 stars, based on 1 article reviews
article 802169 commonly used phluorin - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Addgene inc rg6 plasmid
Rg6 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rg6 plasmid/product/Addgene inc
Average 90 stars, based on 1 article reviews
rg6 plasmid - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

94
Addgene inc sgrna vector cloning 363 single guide rna sgrna sequences
Sgrna Vector Cloning 363 Single Guide Rna Sgrna Sequences, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sgrna vector cloning 363 single guide rna sgrna sequences/product/Addgene inc
Average 94 stars, based on 1 article reviews
sgrna vector cloning 363 single guide rna sgrna sequences - by Bioz Stars, 2026-06
94/100 stars
  Buy from Supplier

86
Synthego Inc paper custom non targeting control ntc grna gcacuaccagagcuaacuca synthego nüssing
Paper Custom Non Targeting Control Ntc Grna Gcacuaccagagcuaacuca Synthego Nüssing, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/paper custom non targeting control ntc grna gcacuaccagagcuaacuca synthego nüssing/product/Synthego Inc
Average 86 stars, based on 1 article reviews
paper custom non targeting control ntc grna gcacuaccagagcuaacuca synthego nüssing - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

92
Addgene inc non target control
Non Target Control, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/non target control/product/Addgene inc
Average 92 stars, based on 1 article reviews
non target control - by Bioz Stars, 2026-06
92/100 stars
  Buy from Supplier

90
Addgene inc non targeting sgrna
Non Targeting Sgrna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/non targeting sgrna/product/Addgene inc
Average 90 stars, based on 1 article reviews
non targeting sgrna - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

91
Addgene inc non targeting guide rna
Non Targeting Guide Rna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/non targeting guide rna/product/Addgene inc
Average 91 stars, based on 1 article reviews
non targeting guide rna - by Bioz Stars, 2026-06
91/100 stars
  Buy from Supplier

Image Search Results