94
|
Addgene inc
non targeting control grna Non Targeting Control Grna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/non targeting control grna/product/Addgene inc Average 94 stars, based on 1 article reviews
non targeting control grna - by Bioz Stars,
2026-06
94/100 stars
|
Buy from Supplier |
93
|
Addgene inc
luciferase Luciferase, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/luciferase/product/Addgene inc Average 93 stars, based on 1 article reviews
luciferase - by Bioz Stars,
2026-06
93/100 stars
|
Buy from Supplier |
94
|
Addgene inc
non targeting control Non Targeting Control, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/non targeting control/product/Addgene inc Average 94 stars, based on 1 article reviews
non targeting control - by Bioz Stars,
2026-06
94/100 stars
|
Buy from Supplier |
90
|
Addgene inc
article 802169 commonly used phluorin Article 802169 Commonly Used Phluorin, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/article 802169 commonly used phluorin/product/Addgene inc Average 90 stars, based on 1 article reviews
article 802169 commonly used phluorin - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
Addgene inc
rg6 plasmid Rg6 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rg6 plasmid/product/Addgene inc Average 90 stars, based on 1 article reviews
rg6 plasmid - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
94
|
Addgene inc
sgrna vector cloning 363 single guide rna sgrna sequences Sgrna Vector Cloning 363 Single Guide Rna Sgrna Sequences, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/sgrna vector cloning 363 single guide rna sgrna sequences/product/Addgene inc Average 94 stars, based on 1 article reviews
sgrna vector cloning 363 single guide rna sgrna sequences - by Bioz Stars,
2026-06
94/100 stars
|
Buy from Supplier |
86
|
Synthego Inc
paper custom non targeting control ntc grna gcacuaccagagcuaacuca synthego nüssing Paper Custom Non Targeting Control Ntc Grna Gcacuaccagagcuaacuca Synthego Nüssing, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/paper custom non targeting control ntc grna gcacuaccagagcuaacuca synthego nüssing/product/Synthego Inc Average 86 stars, based on 1 article reviews
paper custom non targeting control ntc grna gcacuaccagagcuaacuca synthego nüssing - by Bioz Stars,
2026-06
86/100 stars
|
Buy from Supplier |
92
|
Addgene inc
non target control Non Target Control, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/non target control/product/Addgene inc Average 92 stars, based on 1 article reviews
non target control - by Bioz Stars,
2026-06
92/100 stars
|
Buy from Supplier |
90
|
Addgene inc
non targeting sgrna Non Targeting Sgrna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/non targeting sgrna/product/Addgene inc Average 90 stars, based on 1 article reviews
non targeting sgrna - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
91
|
Addgene inc
non targeting guide rna Non Targeting Guide Rna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/non targeting guide rna/product/Addgene inc Average 91 stars, based on 1 article reviews
non targeting guide rna - by Bioz Stars,
2026-06
91/100 stars
|
Buy from Supplier |